Skip to main content
Download PDF

TTN:c.12478del in proximal I-band of titin represents a common molecular cause of dilated cardiomyopathy in Slovenian patients

Orphanet Journal of Rare Diseases volume 20, Article number: 92 (2025) Cite this article

Abstract

Background

Titin truncating variants (TTNtv-s) are the most common genetic cause of dilated cardiomyopathy (DCM). Only rare TTNtv-s in the constitutively expressed exons of the A-band of the protein titin are associated with DCM according to the guidelines, however, studies in large cohorts of patients with DCM suggest that the region where TTNtv-s are associated with DCM is wider, extending at least into the I-band. The aim of this study was to describe the molecular pathology of TTNtv-s in Slovenian patients with cardiomyopathy and to clinically characterise the most recurrent TTNtv.

Results

We collected all TTNtv-s identified in patients with cardiomyopathy using next-generation sequencing genetic testing between 2010 and July 2024, resulting in 42 unique variants identified in 54 patients. The TTN:c.12478del variant, affecting not the A-band but the proximal I-band, specifically the cardiac-specific N2Bus region, was found to be the most recurrent variant, present in seven (11.6%) probands with DCM. Genetic characterisation revealed a probable founder origin of the variant. Clinical characterisation of these probands revealed a phenotype consistent with DCM and severely reduced left ventricular ejection fraction in all probands. Three (43%) of the probands had atrial fibrillation and/or non-sustained ventricular tachycardia. Based on literature reports and evidence supporting the pathogenicity of the TTN:c.12478del variant affecting the proximal I-band, we classified all rare TTNtv-s in constitutively expressed exons of the I-band as (likely) pathogenic. Therefore, 33 (78.6%) TTNtv-s were classified as (likely) pathogenic (13 in the I-band, affecting 19 probands and 20 in the A-band affecting 25 probands), meaning that TTNtv-s were identified in 44 genotype-positive Slovenian probands with DCM, explaining 73.3% of the molecular pathology of DCM.

Conclusion

We report an almost threefold higher diagnostic yield of TTNtv-s in probands with DCM compared to previously reported findings in cohorts of patients with DCM from other populations. We also highlight the need for screening for rare TTNtv-s in the constitutively expressed exons of the I-band and for TTN:c.12478del in patients with DCM in this geographical region.

Background

Dilated cardiomyopathy (DCM) is associated with a genetic cause in 20–50% of patients [1], with the most common pathogenic variants associated with DCM identified in approximately 17% of genotype-positive probands being heterozygous titin truncating variants (TTNtv-s) [2]. TTNtv-s are also identified in ∼ 2% of gnomAD individuals from the control/biobank population (version 3.1.2; 306 individuals with TTNtv-s out of 16,465 individuals) [3, 4]. Diagnostic challenge of distinguishing between benign and pathogenic TTNtv-s remains due to the known incomplete penetrance of the pathogenic TTNtv-s.

Titin is a large protein that extends from the Z-disc through the I- and A-bands to the M-band of the sarcomere and plays an important role in cell structure and elasticity [5, 6]. Titin undergoes alternative splicing, with most variations occurring in the I-band region, where the N2BA and N2B isoforms have been found to predominate in the heart, whereas the N2A isoform prevails in skeletal muscle [7]. Both cardiac isoforms contain a specific N2Bus region, located in exon 48 according to the meta-transcript count [8], which has been shown to be important in providing flexibility as well as binding sites for signalling proteins [9,10,11].

Since rare TTNtv-s in constitutively expressed exons have been found to be strongly linked with DCM, studies in both control populations and patients with DCM indicate that the location and frequency of the TTNtv may be a discriminator [8, 12,13,14,15,16,17]. It is widely accepted that rare TTNtv-s in the constitutively expressed exons of the A-band [15,16,17,18] of the protein titin are causal for DCM. However, there is conflicting evidence on whether this finding applies exclusively to the A-band or extends to the broader gene region [8, 12,13,14].

The present study aimed to search the internal database to extract rare TTNtv-s in constitutively expressed exons identified in probands with cardiomyopathy. Our objectives were to describe the population-specific molecular pathology of TTN variants and to phenotypically characterise the recurrent TTN:c.12478del that is located in the proximal region of the I-band.

Materials and methods

An in-house registry of Mendelian disorders was used to identify probands with cardiomyopathy who were reported to have rare TTNtv-s in constitutively expressed exons of the gene. The TTN:c.12478del variant was the most frequently identified in the probands and segregated in their relatives, and its origin was investigated by haplotype analysis. Probands with the variant and their relatives provided retrospective clinical and radiological data.

Study cohort

Exome/genome sequencing data from approximately 15,000 probands are part of the Mendelian disease registry of genetic test results maintained by the Clinical Institute of Genomic Medicine (CIGM), Ljubljana. We searched for all probands with cardiomyopathy who were referred between January 2010 and July 2024. Sequencing and further bioinformatic data analysis were performed as previously described [19, 20]. Most of the probands were Slovenian, with a smaller proportion coming from neighbouring Balkan countries. We identified 569 probands, referring 268 (47.1%) for hypertrophic cardiomyopathy (HCM), 211 (37.1%) for DCM, 53 (9.3%) for arrhythmogenic cardiomyopathy (ACM), 31 (5.4%) for non-compaction cardiomyopathy (NCC), and 6 (1.1%) for restrictive cardiomyopathy (RCM).As this was a retrospective study, we have used the classification of cardiomyopathies that has been used at the time of referral. Overall, likely pathogenic or pathogenic variants (LP/P) in cardiomyopathy-related genes were identified in 81 (30.1%) probands with HCM, 60 (27.1%) with DCM, 16 (30.2%) with ACM, and 8 (25.8%) with NCC. The test results were screened for all reported variants in TTN (NM_001267550.2) that were either rare or absent in control populations, were located in constitutively expressed exons of the gene, and predicted to cause the truncation of the titin protein (frameshift, nonsense, and disrupting exon splice site variants) (TTNtv-s). Variants were defined as rare if their minor allele frequency was less than 0.01 in the gnomAD control populations [3] and located in constitutively expressed exons if the percentage splice index (PSI) of the exon was 90% or greater [8]. We identified 54 probands with TTNtv-s and included them in the study.

Additionally, a relative in whom TTN:c.12478del was identified by Sanger sequencing to investigate the haplotype surrounding the TTN:c.12478del was also included in the study.

Sequencing and bioinformatics analysis

All probands underwent genetic testing in the form of exome sequencing and data analysis as previously described [19, 20]. The median minimum exome coverage was 100x, and over 98% of targets had at least 10x coverage. The collected data were re-interpreted prior to inclusion in the study, and the PanelApp Dilated Cardiomyopathy and Conduction Defects v.82 virtual panel was used to screen for pathogenic variants in genes associated with DCM. All variants detected were classified according to the ACMG/AMP guidelines for interpretation of sequence variants [21], modified by ACGS recommendations [22]. None of the probands had an additional LP/P variant in the genes known to be associated with DCM [1].

Whole genome sequencing (WGS) was used for haplotype analysis and was performed as described previously [23].

Segregation analysis was offered to all relatives of probands with an identified LP/P TTN variant. The study included only one relative with the TTN:c.12478del, for whom the Sanger sequencing analysis was performed as follows: the region surrounding the variant was amplified using a set of primers (forward primer: 5’ TTGGAGCAAGACAAGCTCACT 3’, reverse primer: 5’ GCACTTTGTGCCTCTTGCTTT 3’), resulting in a PCR product of 428 bp in length. Results were analysed using the latest version of the Geneious® software version 10.2.6.

Haplotype reconstruction of TTN:c.12478del

WGS data were available for six individuals with TTN:c.12478del (five probands (P1.1-P5.1) and one first-degree relative with the variant (P4.2.), making these six individuals the patient population. WGS data were also available for 476 individuals (including 36 trios) with non-cardiac referrals identified in the CIGM database, which were used as a control population.

Haplotype analysis was performed only using data from the control population to identify informative single nucleotide polymorphisms (SNPs). Using vcftools [24], only genotype data for SNPs covering a region of approximately 10 Mbp around the locus of the TTN:c.12478del variant (chr2:174605481–184605481) with a minor allele frequency above 0.48 were filtered out and used for the further analysis, identifying a total of 801 SNPs at this stage. Using vcftools [24] and a list of obtained SNPs, the same genetic data was collected for the patient population. The genotype data from the control and patient populations were accordingly combined into a single file. In order to identify only tag SNPs, PLINK [25] was used with the command “--indep-pairwise” with a window size of 100, a step size of 10, and an r2 threshold of 0.8, resulting in the identification of 133 tag SNPs. The phase of the alleles on the tag SNPs was defined manually in the Excel spreadsheet [26] using first-degree relatives genotypes. SNPs that were not informative (phase could not be defined) were excluded from further analysis. In addition, manual inspection of the raw genomic data using IGV [27] was performed to also exclude SNPs located in poorly covered or complex regions. The final analysis consisted of 22 tag SNPs used to describe the “disease” haplotype. Haploview [28] was then used to determine the frequency of the “disease” haplotype in the control population to test whether the “disease” haplotype was statistically enriched in the patient population.

Microsatellites and two- and three-nucleotide repeats were used in addition to SNPs to describe the haplotype. Therefore, Ensembl [29] was used to define microsatellites and the USCS Genome Browser [30] was searched for known two- and three-nucleotide repeats mapping to the disease haplotype region. No informative microsatellites were found, but two two-nucleotide repeats (21xTG and 22xAC) and one three-nucleotide repeat (16xATT) were identified mapping to the hg19 reference genome on chromosome 2 at nucleotides 178,070,137–178,070,179, 178,845,703–178,845,747, and 178,736,253–178,736,300 respectively.

Clinical characterisation

Individual medical histories were collected retrospectively from medical records. When available, data were obtained for baseline 12-lead resting electrocardiogram (ECG), transthoracic echocardiography (TTE), cardiac magnetic resonance imaging (CMR), and biochemical laboratory tests. Categorical variables are expressed as the number of probands with percentages in brackets, while continuous variables are expressed as mean ± standard deviation with the range in brackets.

A three-generation pedigree was constructed for the segregation study.

Results

TTNtv-s detected in a study cohort

Forty-two unique TTNtv-s were identified in 54 probands (Table 1). Most of them (52, 96%) were identified in probands with DCM, one (2%) in a proband with NCC, and one (2%) in a proband with HCM. Three (7%) variants were classified as pathogenic and thirty (71%) as likely pathogenic, all identified in the probands with DCM. The remaining nine variants were classified as variants of uncertain significance and were identified in probands with DCM, NCC, and HCM. Half (21, 50%) of the variants were detected in the A-band, one-third (14, 33.3%) in the I-band, about one-tenth (5, 11.9%) in the M-band, one (2.4%) in the Z-disc, and one (2.4%) in the border exon between the Z-disc and the I-band. Twenty-six (61.9%) were frameshifts, 14 (33.3%) were nonsense, and two were splice site variants, both affecting the symmetric exon. More than half (25, 59.5%) of the variants were novel. The most common variant identified was c.12478del, which affected seven probands referred for DCM. Additional screening of the CIGM database revealed the presence of the variant in a further five non-cardiac referrals. Most other variants were identified in a single proband, with the exception of c.53228_53232del, which was identified in five probands, and c.97260del and c.103030del, which were identified in two probands.

Table 1 Rare predicted truncating TTN (NM_001267550.2) variants affecting constitutively expressed exons identified in Slovenian probands with cardiomyopathy
Full size table

Haplotype reconstruction

Haplotype analysis revealed a region of approximately 2.2 Mbp shared by all six individuals with TTN:c.12478del used for analysis. The haplotype was found to be significantly enriched in patients with TTN:c.12478del (p = 8.217E-45) compared to probands with non-cardiac referrals. The results of the analysis are presented in Table 2.

Table 2 Haplotype analysis in five probands with TTN:c.12478del (P1.1-P5.1) and one first-degree relative (P4.2)
Full size table

Classification of a TTN:c.12478del

The TTN:c.12478del, p.(Thr4160fs), is a frameshift variant and is expected to result in a truncation of the titin protein, thereby affecting the function of the protein. Several lines of evidence support the pathogenicity of the variant, as it, first, affects a constitutively expressed exon in the titin I-band, where TTNtv-s variants are more frequent in patients with DCM (odds ratio of 19.0) than in the general population, but with a lower risk of DCM than A-band variants (odds ratio 49.8) [8]. Second, the variant is very rare in control populations, having only been identified in one individual from the GnomAD control population [3] and five in the CIGM database. Third, the variant was identified in seven probands with DCM in the CIGM database and in one individual with DCM reported in the ClinVar database (Variation ID: 1403910).

The variant was classified as pathogenic (criteria used: PVS1_STR, PS4, PM2) according to the standards and guidelines for the interpretation of sequence variants established by the ACMG/AMP [21, 31], modified by the ACGS recommendations [22].

Phenotypic characterization of probands with TTN:c.12478del

Detailed medical histories were available for seven probands with TTN:c.12478del and DCM, for three out of four of their relatives with the variant, and for one proband with a non-cardiac referral. Summary statistics of the phenotypic findings in the probands are presented in Table 3.

Table 3 Clinical characteristics of seven probands with DCM and TTN:c.12478del
Full size table

On average, the probands were diagnosed with DCM in their sixth decade, with one proband presenting earlier, at the age of 39. Five were male. Two reported a family history of DCM, while none reported a relevant family history of sudden cardiac death. At baseline, two probands had mild symptoms and limitations in normal activities, while five had marked limitations. Arrhythmias were observed in three probands. One had both atrial and ventricular arrhythmias, and two others had either atrial or ventricular arrhythmias. Six probands had abnormal ECG findings. Transthoracic imaging showed an enlarged left ventricle and severely reduced left ventricular ejection fraction (LVEF) in all probands. More than half had subepicardial areas of late gadolinium enhancement (LGE), which were considered likely to be myocardial fibrosis. All probands had significantly elevated levels of NT-proBNP, whereas creatine kinase was within the normal range. One of them experienced sudden cardiac death due to ventricular tachycardia and was resuscitated, received an implantable cardioverter defibrillator (ICD), and later underwent a successful heart transplantation. Two other probands had an ICD implanted, one for primary and one for secondary prevention.

Discussion

In line with findings in patients with DCM from other populations, the present study shows that (likely) pathogenic TTNtv-s represent a significant genetic contributor in the aetiology of DCM in Slovenian patients [1, 2]. In particular, TTNtv-s were reported in almost three quarters (73.3%) of the genotype-positive probands with DCM, a proportion three times higher than previously observed [1, 2]. With c.12478del identified in 11.6% of genotype-positive probands with DCM, this study also provides further evidence that rare TTNtv-s in the constitutively expressed exons of the proximal I-band region are a relevant cause of DCM.

Extensive research into the exact mechanism of pathogenicity of TTNtv-s is ongoing [32]. In addition to earlier reports suggesting insufficiency of untruncated titin [12] and deregulation of translation as a pathomechanism [33], recent studies have provided evidence for a toxic peptide mechanism involving either incorporation of truncated titin into the sarcomere or its accumulation as intracellular aggregates and impaired intracellular protein quality control [12, 34, 35].

The present study’s genetic analysis revealed the presence of rare TTNtv-s in the constitutively expressed exons in all titin bands in the patients with cardiomyopathy. In a large case-control study, those TTNtv-s in the A- and I-band were found to be highly associated with DCM, with an odds ratios of 49.8 for variants in the A-band and 19.0, 19.5, and 32.0 for the I-band, respectively [8]. The disease-causing TTNtv-s were detected in the A- and I-band in 44 (73.3%) Slovenian probands with DCM. In the same case-control study, it was found that rare TTNtv-s in the constitutively expressed exons located in the Z-disc and M-band were associated with DCM, but the odds ratios were much lower, at 5.3 and 3.7 for the Z-disc and M-band, respectively [8]. In view of this finding and the lack of evidence in the literature, we did not apply the PVS1_STR criterion to the TTNtv-s in the M-band and Z-disc and thus classified them as VUS. However, this may change in the near future as studies in large cohorts suggest that rare TTNtv-s are enriched across the entire gene in patients with DCM [8, 12,13,14].

Interestingly, the most common variant identified in the present cohort, TTN:c.12478del, does not affect the distal part of the titin but the proximal region of the I-band. It is located in the exon 48, which corresponds to the exon 46 in the N2BA transcript and the exon 45 in the N2B transcript, the predominant cardiac isoforms [16]. This exon is not included in the transcript of the N2A isoform, which is the most abundant isoform in skeletal muscle [7]. Six variants in exon 48 have been reported in the literature in patients with DCM [16, 36,37,38,39], indicating the importance of this region in the development of the DCM phenotype. Further, TTN:c.12478del is located in the cardiac-specific N2Bus region [10, 11], the importance of which has been demonstrated by mice and zebrafish models [40,41,42,43,44]. Studies in both models have provided valuable insights into why the presence of this region is critical for normal cardiac function. However, in both models the variant was present in a biallelic state, so the findings cannot be directly extrapolated to determine the pathogenicity of DCM, as pathogenic TTN variants in patients with DCM are most commonly found in the heterozygous state. Recently, the zebrafish model has been developed to study TTNtv-s in the heterozygous state, providing a framework for further functional studies of TTNtv-s [45].

Consistent with existing reports of patients with TTNtv-s, seven affected individuals with TTN:c.12478del presented with DCM, were diagnosed in mid-adulthood [46, 47], and were predominantly male (71%) [15, 36, 46, 48]. All had an LV dysfunction, independent of the presence of fibrosis, which was present in 57% [49]. One proband had a heart transplantation performed and three had an ICD implanted. Arrhythmias were observed in 43% of probands. Previous studies have been inconclusive as to whether the prevalence of atrial and ventricular arrhythmias is increased in patients with DCM and TTNtv-s compared to those without TTNtv-s [13, 36, 46, 48, 50], ranging up to 43% for atrial [46] and 50% for ventricular [13] arrhythmias. The small sample size may bias our observations of a fairly high incidence. Although only two probands reported a family history of DCM, the haplotype analysis showed that the variant is most likely to be located on the haplotype segment that is common to all individuals with the variant, suggesting that the variant is more likely to have arisen in a common ancestor. Functional studies to determine the effect of the variant on the protein product were beyond the scope of this study.

Conclusions

Our study elucidated the molecular pathology of TTN variants in Slovenian patients with cardiomyopathy and presented the clinical manifestation of the recurrently identified TTN:c.12478del, moreover, it contributes to the understanding of the genetic background in this geographical region and highlights the importance of screening for rare TTNtv-s in the constitutively expressed exons of the I-band of the gene TTN in patients with DCM.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

References

  1. Wilde AAM, Semsarian C, Márquez MF, Sepehri Shamloo A, Ackerman MJ, Ashley EA, et al. European heart rhythm association (EHRA)/Heart rhythm society (HRS)/Asia Pacific heart rhythm society (APHRS)/Latin American heart rhythm society (LAHRS) expert consensus statement on the state of genetic testing for cardiac diseases. J Arrhythmia. 2022;38:491–553.

    Article  Google Scholar 

  2. Fang H-J, Liu B-P. Prevalence of TTN mutations in patients with dilated cardiomyopathy: A meta-analysis. Herz. 2020;45:29–36.

    Article  PubMed  Google Scholar 

  3. Gudmundsson S, Singer-Berk M, Watts NA, Phu W, Goodrich JK, Solomonson M, et al. Variant interpretation using population databases: lessons from GnomAD. Hum Mutat. 2022;43:1012–30.

    Article  PubMed  Google Scholar 

  4. Akinrinade O, Koskenvuo JW, Alastalo T-P. Prevalence of titin truncating variants in general population. Krahe R, editor. PLoS ONE. 2015;10:e0145284.

  5. Granzier HL, Irving TC. Passive tension in cardiac muscle: contribution of collagen, titin, microtubules, and intermediate filaments. Biophys J. 1995;68:1027–44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Labeit S, Kolmerer B. Titins: giant proteins in charge of muscle ultrastructure and elasticity. Science. 1995;270:293–6.

    Article  CAS  PubMed  Google Scholar 

  7. Bang ML, Centner T, Fornoff F, Geach AJ, Gotthardt M, McNabb M, et al. The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ Res. 2001;89:1065–72.

    Article  CAS  PubMed  Google Scholar 

  8. Schafer S, De Marvao A, Adami E, Fiedler LR, Ng B, Khin E, et al. Titin-truncating variants affect heart function in disease cohorts and the general population. Nat Genet. 2017;49:46–53.

    Article  CAS  PubMed  Google Scholar 

  9. Linke WA, Rudy DE, Centner T, Gautel M, Witt C, Labeit S, et al. I-band titin in cardiac muscle is a three-element molecular spring and is critical for maintaining thin filament structure. J Cell Biol. 1999;146:631–44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Sun Y, Liu X, Huang W, Le S, Yan J. Structural domain in the titin N2B-us region binds to FHL2 in a force-activation dependent manner. Nat Commun. 2024;15:4496.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. van der Pijl RJ, Domenighetti AA, Sheikh F, Ehler E, Ottenheijm CAC, Lange S. The titin N2B and N2A regions: biomechanical and metabolic signaling hubs in cross-striated muscles. Biophys Rev. 2021;13:653–77.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Fomin A, Gärtner A, Cyganek L, Tiburcy M, Tuleta I, Wellers L, et al. Truncated titin proteins and titin haploinsufficiency are targets for functional recovery in human cardiomyopathy due to TTN mutations. Sci Transl Med. 2021;13:eabd3079.

    Article  CAS  PubMed  Google Scholar 

  13. Akhtar MM, Lorenzini M, Cicerchia M, Ochoa JP, Hey TM, Sabater Molina M, et al. Clinical phenotypes and prognosis of dilated cardiomyopathy caused by truncating variants in the TTN gene. Circ Heart Fail. 2020;13:e006832.

    Article  CAS  PubMed  Google Scholar 

  14. Akinrinade O, Alastalo T-P, Koskenvuo JW. Relevance of truncating titin mutations in dilated cardiomyopathy. Clin Genet. 2016;90:49–54.

    Article  CAS  PubMed  Google Scholar 

  15. Herman DS, Lam L, Taylor MRG, Wang L, Teekakirikul P, Christodoulou D, et al. Truncations of titin causing dilated cardiomyopathy. N Engl J Med. 2012;366:619–28.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Roberts AM, Ware JS, Herman DS, Schafer S, Baksi J, Bick AG et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci Transl Med. 2015 [cited 2024 Jun 17];7. Available from: https://doiorg.publicaciones.saludcastillayleon.es/10.1126/scitranslmed.3010134

  17. Jolfayi AG, Kohansal E, Ghasemi S, Naderi N, Hesami M, MozafaryBazargany M, et al. Exploring TTN variants as genetic insights into cardiomyopathy pathogenesis and potential emerging clues to molecular mechanisms in cardiomyopathies. Sci Rep. 2024;14:5313.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Morales A, Kinnamon DD, Jordan E, Platt J, Vatta M, Dorschner MO, et al. Variant interpretation for dilated cardiomyopathy: refinement of the American college of medical genetics and genomics/clingen guidelines for the DCM precision medicine study. Circ Genom Precis Med. 2020;13:e002480.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Maver A, Lovrecic L, Volk M, Rudolf G, Writzl K, Blatnik A, et al. Phenotype-driven gene target definition in clinical genome-wide sequencing data interpretation. Genet Sci. 2016;18:1102–10.

    Google Scholar 

  20. Bergant G, Maver A, Lovrecic L, Čuturilo G, Hodzic A, Peterlin B. Comprehensive use of extended exome analysis improves diagnostic yield in rare disease: a retrospective survey in 1,059 cases. Genet Med. 2018;20:303–12.

    Article  PubMed  Google Scholar 

  21. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American college of medical genetics and genomics and the association for molecular pathology. Genet Sci. 2015;17:405–24.

    Google Scholar 

  22. Durkie M, Cassidy E-J, Berry I, Owens M, Turnbull C, Taylor RW et al. ACGS best practice guidelines for variant classification in rare disease. 2024.

  23. Bergant G, Maver A, Peterlin B. Whole-genome sequencing in diagnostics of selected Slovenian undiagnosed patients with rare disorders. Life (Basel). 2021;11:205.

    CAS  PubMed  Google Scholar 

  24. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA, et al. The variant call format and vcftools. Bioinformatics. 2011;27:2156–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007;81:559–75.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Microsoft Corporation. Microsoft Excel. Available from: https://www.microsoft.com/sl-si/microsoft-365/excel?legRedir=true&CorrelationId=b643d8c1-1038-42ab-a5db-36aa34fb9415

  27. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29:24–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263–5.

    Article  CAS  PubMed  Google Scholar 

  29. Martin FJ, Amode MR, Aneja A, Austine-Orimoloye O, Azov AG, Barnes I, et al. Ensembl 2023. Nucleic Acids Res. 2023;51:D933–41.

    Article  CAS  PubMed  Google Scholar 

  30. Nassar LR, Barber GP, Benet-Pagès A, Casper J, Clawson H, Diekhans M, et al. The UCSC genome browser database: 2023 update. Nucleic Acids Res. 2023;51:D1188–95.

    Article  CAS  PubMed  Google Scholar 

  31. Abou Tayoun AN, Pesaran T, DiStefano MT, Oza A, Rehm HL, Biesecker LG, et al. Recommendations for interpreting the loss of function PVS1 ACMG/AMP variant criterion. Hum Mutat. 2018;39:1517–24.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Loescher CM, Hobbach AJ, Linke WA. Titin (TTN): from molecule to modifications, mechanics, and medical significance. Cardiovascular Res. 2022;118:2903–18.

    Article  CAS  Google Scholar 

  33. Van Heesch S, Witte F, Schneider-Lunitz V, Schulz JF, Adami E, Faber AB, et al. The translational landscape of the human heart. Cell. 2019;178:242–e26029.

    Google Scholar 

  34. McAfee Q, Chen CY, Yang Y, Caporizzo MA, Morley M, Babu A, et al. Truncated titin proteins in dilated cardiomyopathy. Sci Transl Med. 2021;13:eabd7287.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Kellermayer D, Tordai H, Kiss B, Török G, Péter DM, Sayour AA, et al. Truncated titin is structurally integrated into the human dilated cardiomyopathic sarcomere. J Clin Invest. 2024;134:e169753.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Jansweijer JA, Nieuwhof K, Russo F, Hoorntje ET, Jongbloed JDH, Lekanne Deprez RH, et al. Truncating titin mutations are associated with a mild and treatable form of dilated cardiomyopathy. Eur J Heart Fail. 2017;19:512–21.

    Article  CAS  PubMed  Google Scholar 

  37. Walsh R, Thomson KL, Ware JS, Funke BH, Woodley J, McGuire KJ, et al. Reassessment of Mendelian gene pathogenicity using 7,855 cardiomyopathy cases and 60,706 reference samples. Genet Sci. 2017;19:192–203.

    Google Scholar 

  38. Gigli M, Merlo M, Graw SL, Barbati G, Rowland TJ, Slavov DB, et al. Genetic risk of arrhythmic phenotypes in patients with dilated cardiomyopathy. J Am Coll Cardiol. 2019;74:1480–90.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Mazzarotto F, Hawley MH, Beltrami M, Beekman L, de Marvao A, McGurk KA, et al. Systematic large-scale assessment of the genetic architecture of left ventricular noncompaction reveals diverse etiologies. Genet Med. 2021;23:856–64.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Radke MH, Peng J, Wu Y, McNabb M, Nelson OL, Granzier H, et al. Targeted deletion of titin N2B region leads to diastolic dysfunction and cardiac atrophy. Proc Natl Acad Sci USA. 2007;104:3444–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Xu X, Meiler SE, Zhong TP, Mohideen M, Crossley DA, Burggren WW, et al. Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat Genet. 2002;30:205–9.

    Article  CAS  PubMed  Google Scholar 

  42. Lee E-J, Peng J, Radke M, Gotthardt M, Granzier HL. Calcium sensitivity and the Frank-Starling mechanism of the heart are increased in titin N2B region-deficient mice. J Mol Cell Cardiol. 2010;49:449–58.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Nedrud J, Labeit S, Gotthardt M, Granzier H. Mechanics on myocardium deficient in the N2B region of titin: the cardiac-unique spring element improves efficiency of the cardiac cycle. Biophys J. 2011;101:1385–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Lee E-J, Nedrud J, Schemmel P, Gotthardt M, Irving TC, Granzier HL. Calcium sensitivity and myofilament lattice structure in titin N2B KO mice. Arch Biochem Biophys. 2013;535:76–83.

    Article  CAS  PubMed  Google Scholar 

  45. Zhu P, Li J, Yan F, Islam S, Lin X, Xu X. Allelic heterogeneity of TTNtv dilated cardiomyopathy can be modeled in adult zebrafish. JCI Insight. 2024;9:e175501.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Vissing CR, Rasmussen TB, Dybro AM, Olesen MS, Pedersen LN, Jensen M, et al. Dilated cardiomyopathy caused by truncating titin variants: long-term outcomes, arrhythmias, response to treatment and sex differences. J Med Genet. 2021;58:832–41.

    Article  CAS  PubMed  Google Scholar 

  47. Zaklyazminskaya E, Mikhailov V, Bukaeva A, Kotlukova N, Povolotskaya I, Kaimonov V, et al. Low mutation rate in the TTN gene in paediatric patients with dilated cardiomyopathy - a pilot study. Sci Rep. 2019;9:16409.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Tayal U, Newsome S, Buchan R, Whiffin N, Halliday B, Lota A, et al. Phenotype and clinical outcomes of titin cardiomyopathy. J Am Coll Cardiol. 2017;70:2264–74.

    Article  PubMed  PubMed Central  Google Scholar 

  49. Jacobs J, Van Aelst L, Breckpot J, Corveleyn A, Kuiperi C, Dupont M, et al. Tools to differentiate between filamin C and titin truncating variant carriers: value of MRI. Eur J Hum Genet. 2023;31:1323–32.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Verdonschot JAJ, Hazebroek MR, Derks KWJ, Barandiarán Aizpurua A, Merken JJ, Wang P, et al. Titin cardiomyopathy leads to altered mitochondrial energetics, increased fibrosis and long-term life-threatening arrhythmias. Eur Heart J. 2018;39:864–73.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

The authors thank the probands, their families, and CIGM laboratory members for their contributions.

Funding

The study was partially funded by the Slovenian Research and Innovation Agency (grant number P3-0326).

Author information

Authors and Affiliations

  1. Clinical Institute of Genomic Medicine, University Medical Centre Ljubljana, Ljubljana, Slovenia

    Nina Vodnjov, Aleš Maver, Borut Peterlin & Karin Writzl

  2. Biotechnical Faculty, University of Ljubljana, Ljubljana, Slovenia

    Nina Vodnjov

  3. Department of Cardiology, University Medical Centre Ljubljana, Ljubljana, Slovenia

    Andraž Cerar

  4. Faculty of Medicine, University of Ljubljana, Ljubljana, Slovenia

    Aleš Maver & Karin Writzl

  5. European Reference Network for Rare, Low Prevalence, Or Complex Diseases of the Heart (ERN GUARD-Heart), Amsterdam, The Netherlands

    Karin Writzl

Authors
  1. Nina Vodnjov
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Andraž Cerar
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Aleš Maver
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Borut Peterlin
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Karin Writzl
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

NV and KW designed the study. NV and AC performed data curation and formal analysis. AM provided software. BP provided the resources and supervised the study. NV performed an investigation and wrote the first draft, and all authors contributed to revisions and editing of the manuscript.

Corresponding author

Correspondence to Karin Writzl.

Ethics declarations

Ethical approval and consent to participate

The study adhered to the Declaration of Helsinki and was approved by the National Medical Ethics Committee of Slovenia (Approval No. 0120 − 71/2022/3, dated 28/03/2022). Written informed consent to use the data for research purposes was obtained from all study participants.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests. Sponsors had no role in study design, execution, interpretation, or writing.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Vodnjov, N., Cerar, A., Maver, A. et al. TTN:c.12478del in proximal I-band of titin represents a common molecular cause of dilated cardiomyopathy in Slovenian patients. Orphanet J Rare Dis 20, 92 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13023-025-03613-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13023-025-03613-7

Keywords

Orphanet Journal of Rare Diseases

ISSN: 1750-1172